SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma20g01470

Feature Type:gene_model
Chromosome:Gm20
Start:1002861
stop:1006434
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G17790AT Annotation by Michelle Graham. TAIR10: purple acid phosphatase 17 | chr3:6089779-6090988 FORWARD LENGTH=338 SoyBaseE_val: 1.00E-147ISS
GO:0016036GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to phosphate starvation SoyBaseN/AISS
GO:0019375GO-bp Annotation by Michelle Graham. GO Biological Process: galactolipid biosynthetic process SoyBaseN/AISS
GO:0030643GO-bp Annotation by Michelle Graham. GO Biological Process: cellular phosphate ion homeostasis SoyBaseN/AISS
GO:0042542GO-bp Annotation by Michelle Graham. GO Biological Process: response to hydrogen peroxide SoyBaseN/AISS
GO:0045892GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0005576GO-cc Annotation by Michelle Graham. GO Cellular Compartment: extracellular region SoyBaseN/AISS
GO:0009986GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cell surface SoyBaseN/AISS
GO:0003993GO-mf Annotation by Michelle Graham. GO Molecular Function: acid phosphatase activity SoyBaseN/AISS
GO:0004722GO-mf Annotation by Michelle Graham. GO Molecular Function: protein serine/threonine phosphatase activity SoyBaseN/AISS
GO:0016787GO-mf Annotation by Michelle Graham. GO Molecular Function: hydrolase activity SoyBaseN/AISS
GO:0016791GO-mf Annotation by Michelle Graham. GO Molecular Function: phosphatase activity SoyBaseN/AISS
KOG2679 KOG Purple (tartrate-resistant) acid phosphatase JGI ISS
PTHR10161Panther ACID PHOSPHATASE-RELATED JGI ISS
PF00149PFAM Calcineurin-like phosphoesterase JGI ISS
UniRef100_B9T6A8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Tartrate-resistant acid phosphatase type 5, putative n=1 Tax=Ricinus communis RepID=B9T6A8_RICCO SoyBaseE_val: 2.33E-156ISS
UniRef100_I1ND52UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1ND52_SOYBN SoyBaseE_val: 0ISS

LocusGene SymbolProtein Name
PAP34 Purple acid phosphatase 34 gene
PAP34 Purple acid phosphatase gene 34

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.20g011900 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma20g01470.1   sequence type=CDS   gene model=Glyma20g01470   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTTCCCCATCATCTCCCCTTCATTCAGCAGCAATTTTATGCATATATTTTGTGCTACCCGCTTTTGCAGAGCTTCAGAGGTTCCAACATCAACCAAAACATGATGGATCCCTCAACTTTCTAGTCATTGGAGATTGGGGTAGAAAAGGGCATTATAATCAATCCCTTGTAGCCACACAGATGGGAAAGATGGGAGACAAACTTGATTTAGATTTTGTTGTATCAACTGGAGACAATTTCTACAATAGTGGGTTAAAAGGTGTAAATGATCCATTATTTCTGCAGTCATTTTCCAACATTTACACTGCTAAGAGCCTTAGGAAGCAATGGTACTCTGTTTTGGGAAACCATGACTATAGGGGTAATGCACTGGCACAGTTAAGTCCACTCTTGAGGAAGATTGACAGGAGATGGTTTTGCCAGAGATCATTTATTCTTAATGCAGGAGTTGCTGAATTTTTCTTCATAGACACAACCCCGTTTATGAGAAAATATTTCAACAATTCGAATCGTCACTATGATTGGCGAGGCGTGCTTCCGAGGCAAAAATACCTCAAAACCCTTCTGAAGGATCTTGAGGAAGAATTGAGGAAATCAACTGCAAGATGGAAAATCGCTGTGGGTCACCATGCAATAAGAAGTATTGGCCATCACGGTGATAGTCCAGAACTTGTAAAGCACCTTGTCCCAGTACTTAAGGCCAACAATGTTGACATGTACATAAATGGGCATGACCATTGCCTCCAACATATAAGCAGCACAGATAGCCCACTTCTATATTTAACGAGTGGAGCAGGATCAAAGGCATGGAGAGGTGATGTTAAAGAAACCCACTTTGATGTGAAATTCTTTTATGATGGTCAAGGTTTCATGTCTGTTCAAATGACTGAAAATGACACAAATTTTGCTTTCTACAATGTCTTTGGTGAGAAGATACACCATTGGAAAGTGACTAAGTCCACGATGCATCCTTCTATATGA

>Glyma20g01470.1   sequence type=predicted peptide   gene model=Glyma20g01470   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASPSSPLHSAAILCIYFVLPAFAELQRFQHQPKHDGSLNFLVIGDWGRKGHYNQSLVATQMGKMGDKLDLDFVVSTGDNFYNSGLKGVNDPLFLQSFSNIYTAKSLRKQWYSVLGNHDYRGNALAQLSPLLRKIDRRWFCQRSFILNAGVAEFFFIDTTPFMRKYFNNSNRHYDWRGVLPRQKYLKTLLKDLEEELRKSTARWKIAVGHHAIRSIGHHGDSPELVKHLVPVLKANNVDMYINGHDHCLQHISSTDSPLLYLTSGAGSKAWRGDVKETHFDVKFFYDGQGFMSVQMTENDTNFAFYNVFGEKIHHWKVTKSTMHPSI*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo